freeanswers81
freeanswers81
Today at 11:44 PM
Arts
Answered
Where is Addison Rae from
Answer :
jennagus
jennagus
Today at 11:49 PM
Answer:
Lafayette, Louisiana
Explanation:
Answer Link
jlwalls1
jlwalls1
Today at 11:48 PM
Answer:
Lafayette La
Explanation:
I love Addison! Have a great day!
Answer Link
VIEW ALL ANSWERS ( 74+ )
Other Questions
Drat is a product of the Digby company. Digby's sales forecast for Drat is 1861 units. Digby wants to have an extra 10% of units on hand above and beyond their
Chapter 14, Problem 042 A flotation device is in the shape of a right cylinder, with a height of 0.588 m and a face area of 4.19 m2 on top and bottom, and its d
Chapter 14, Problem 042 A flotation device is in the shape of a right cylinder, with a height of 0.588 m and a face area of 4.19 m2 on top and bottom, and its d
Drat is a product of the Digby company. Digby's sales forecast for Drat is 1861 units. Digby wants to have an extra 10% of units on hand above and beyond their
An outside supplier recently began producing a comparable motor that could be used in the sewing machine. The price offered to SP Corporation for this motor is
Draw a triangle of side 4 cm 5cm and 6cm draw na isosceles triangle with same base and area
What happens when we react (Zn + HNO3 )?
paid cash to macmillian and co. rs 11900 and recieved discount 100
What is relative pronoun can use Ram house we live in ,is an engineer
Where do traffic jams come from?
Which passage from the Article best supports the idea that the Svalbard Global Seed Vault is meant to protect seeds in the event of a disaster? The blue and whi
The way a piece of writing is organized is called its .
Deshawn invest $400 in an account that earns 0.41% monthly interest complete the statement
what do the witches in Macbeth predict for Banquo
Since 1945, what have been the three biggest historical events in American history?
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?
The cost for the medium pizza is $14 and the cost for the large pizza is $17. Which pizza has a lower per square inch cost?
My name is Jeff Tucker, and I am the class president of Windemere Middle School’s sixth grade. Our school is having an open house on Thursday, January 18, at 4:
What is the definition of money, according to Kemp?
Knowing that sin 30º = 3, what is a?
