sarah542 sarah542

Today at 6:45 AM
Social Studies

Answered

QUICK!!!!!!!!percy Jackson battle of the labrynth chapter 19(who defends grover?)

Answer :

georgepacheco georgepacheco

Today at 6:50 AM

Answer:Juniper, annabeth,and percy

Explanation:

Answer Link

Other Questions

Help me with this please!!!

Giving brainliest !!!!!!!

Help me pls pls pls

Which equation is not equivalent to 2x + 14 = 4x - 6a) 14 +6 = 2x b) -2x =20c) 2x - 4x = -20d) x = 10

Giving brainliest !!!!!!!

True friends are not .

Harrison mows lawns and rakes leaves for his summer and fall weekend jobs. He gets $10 an hour to mow lawns and $8 an hour to rake leaves. If, during September,

Your school recently celebrated ‘World Nature Conservation Day’. Write a report in 150-180 words describing the event

Convert the following numbers as directed (i) Decimal 198.25 into binary and hexadecimal (ii) Decimal 444566 into binary and hexadecimal (iii) String “Maximum L

In mountainous area, there is a change in natural vegetatiin due to decrease in temperature, Justify giving examples frim different zone?

What information would you expect to read under this heading in the article “See the World! Study Abroad”?

Will mark brainliest if ur correct! Pls and ty

A person running at 5 mph puts on a burst of speed to finish a race at 7 mph. What is the delta velocity? A. -2 B. 7 C. 5 D.2

please answer part A and B with an explanation (7th grade) 20 points!!

Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTA

Everything had been arranged with the utmost care. All the good things to eat were spread out upon the rocks by the sea. A gay sparkling little brook brought wa

50 x = 30 •3 •5 •3/5 •5/3 Help please!

What are the reasons for battery problems? How can these problems be corrected?

Based on everything that you have learned, was Manifest Destiny justified?

Select the correct image. Which structure is a valid representation of a hydrocarbon molecule? Н 1 Н-С-Н. Н Н Н Н Н 1 н-с-н Н Н Н Н 1 1 1 1 Н-С—С—С—С—С-Н 1 1 1