justinap444 justinap444

Today at 4:09 AM
Biology

Answered

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

Answer :

aleecha107 aleecha107

Today at 4:14 AM

Answer:

TTAACGCTAGCGAGCATGGCC

Explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

Answer Link

Other Questions

The space between each rail on a deck is 3/4 of a foot. If the carpenter wants there to be 1/2 of a foot less space between each rail, what will the new spacing

Which values are solutions to the inequality below

Francisco forgot to pay the $50 water bill. The company charges you a 12% fine. How much does Francis have to pay including the fine?

Which values are solutions to the inequality below

Find the zero of a function for n(x)= -6x+18, please show your work.

Urgent Answer for this question

Write a paragraph in about 150 words organising a class party on the last day of term

the helicopter hoveredus.

கழிவுகளை மேலாண்மை செய்வதற்காக கீழுள்ளவற்றுள் எவற்றினை நீவிர் பயன்படுத்துவீர்? அ) கழிவுகள் உருவாகும் அளவைக் குறைத்தல். ஆ) கழிவுகளை மறு பயன்பாட்டு முறையில் பயன்பட

The hypotenuse of a right angledtriangle is 25 and its perpendicular distance is 7cm find the length of a base

Distribute 8[(x + (-3)]

Simplify the expression. 2(5+9)-6

What should I draw just asking because I’m

HELPPPPPPPPPPPPPPPPPPPO

Potential energy is... A. always increasing. B. the energy of motion. C. weakest at high temperatures. D. dependent on an object's position

List some reasons why political parties are important

What is my number? Clue 1: If you divide my number by 5, the remainder is 4 Clue 2: My number has two digits and both are even.

According to richard rodriguez how can language define community

WOULD YOU PLEASEEE HELP MEEEE

3.Which text structure is best for an autobiography?