hayle11131 hayle11131

Today at 4:22 PM
English

Answered

Which of the following words best fills the blank?

Which of the following words best fills the blank? class=

Answer :

Alysssssssssssa Alysssssssssssa

Today at 4:27 PM

Your correct answer is most likely A. I hope this helped!

Answer Link

Other Questions

Simplify this expression

Can you determine the number of digits in the quotient of 637/7 without dividing? Explain

put x^2+15x+56 and make it into a word problem!

What is the author's purpose for including the section "Osiris and Set" in the Newsela article "How Ancient Egyptians Shaped the World's View of Life After Deat

What is royal regalia?

What led british to record every aspect of their administration in india. were they able to answer anybody

what was the most fertile land called during Mughal period

find the polynomial whose zeros of are given as under a= 2, B = 3

+ and + equal to ,- or plus

xlvi+lxx= please answer in xl language

Choose the linear equation written in slope intercept form that matches each graph

Can someone please give me the correct answer

Write the verb phrase. 1. Haven’t you finished yet? 2. It’s made of wool. 3. Didn’t they appear in 1950? 4. They’d feared its return. 5. They’ve found the coin.

x2+5x−7 when x=2 can you help me i am wayy back of the class and next month grades close

Can someone please help me with this problem ? I would love y’all forever !

Does anyone know how to convert meters per second into miles per hour? if possible, plz post the exact equation

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

PLEASEEE HELP ITS FOR A GOOD CAUSE !!

PLEASE HELP QUICKLY! ANSWER AS MANY AS POSSIBLE. DO NOT ONLY SAY "I don't know" 1. How do we know the continents were ever connected (what evidence do we have)?

Is 5 ft 9 and 139 lbs fat for a woman? oops! i meant 193