prisongames8 prisongames8

Today at 4:29 AM
History

Answered

For what reason did Gouverneur Morris change the opening of the Constitution’s preamble?

Answer :

titigaitan2006 titigaitan2006

Today at 4:34 AM

Answer: One might conclude that the change Morris made rendered the Constitution a much more nationalist document.

Explanation:

Answer Link

Other Questions

Steps to writing a essay

Question is a question

What are the differences among traditional, command, and market economies?

the science club meets every four days in the math club meets every 6 days when is the next time that the math and science club will meet on the same day?

Question is a question

details study of applications of. Fourier series In signal processing with mathematical example

jaya baught two sarees for rs 800 each .she sold one at gain of5% and other at a loss of 4%.find her gain or loss present in whole transactions.

Correct the mistake in the following. The cause of tooth decay in base . To neutralize it tooth paste contains acid

calculate the relative molecular mass of methane carbonate.

Tea.......(ii) Who can solve this questions?By whom.......SU

are these correct !! History

How many moles of NaCl are found in 5.2L of a 0.75 M solution?

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Item 5 Write the word sentence as an inequality. One plus a number y is no more than −13.

Write the equation of the graph.

The table shows some ordered pairs that belong to a quadratic function.

What were 2 reasons why James Braddick was able to rejuvenate his boxing career?

Line B in the given graph represents the reaction with an enzyme added to substrates. How did the enzyme affect the reaction?

How do virus cause disease

find the function. f(-7) if f(x) = 8x+15f(-7) = -4?70