Today at 1:16 AM
Mathematics

Answered

Area of ice rink is 404 sq yes what is perimeter

Answer :

Аноним Аноним

Today at 1:21 AM

Ok, since the ice rink is a square (which has equal sides) if you multiply 404 times four because a square has 4 sides which is equal to 1616 the perimiter is 1616 sqf

404*4= 1616 p= 1616sq

Answer Link

Other Questions

Which of these samples of water has the most internal energy? 1kg Liquid Water 2kg Steam 1kg Steam 2kg Ice

Where are the pigments that trap the photons (light energy)? A. in the stroma of the chloroplast B. in the mitochondria C. in the thylakoid disks of the chlorop

Según la cinética química para que una reacción ocurra, los átomos o moléculas deben I. Chocar con la suficiente energía. II. Chocar con una concentración adecu

Where are the pigments that trap the photons (light energy)? A. in the stroma of the chloroplast B. in the mitochondria C. in the thylakoid disks of the chlorop

A man inherits dominant allele for the trait from father and recessive allele from mother. what trait will this man expressed which alleles will his sperm cell

Which is greater? 0.10 or 0.50

summary of heart of the tree

Can anybody name an alkaline fruit which test red colour using turmeric indicator?

you have planned to visit the police station what are the 20 questions u will ask

m^3-n^3-m(m^2-n^2)+n(m-n) ^3

You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA What is the

what is the y intercept of 5x-2y=10

Tim wants to purchase a new computer and go to the Caribbean for spring break. The computer is priced at $1,299, and the vacation is priced at $750. He has only

A horizontal curve is being designed around a pond with a tangent length of 1200 ft and a central angle of 29.86 degrees. If the PI is at station 145 00, determ

Carroll bikes 1 kilometer east, 4 kilometers north, and then 5 kilometers east again. How far is Carroll from her starting position?

Last month, Claire's bank statement said that she overdrew her account. Her bank balance was -45.32−45.32minus, 45, point, 32 euros.

1.A micelle is a spherical structure compose of a single layer of phospholipids. After looking at the different spherical structures in one of your cups, what t

I found a brand-new charger wire still in its plastic package, but it's six years old and has never been used. Is it safe to use?

Lilly had 14 pieces of chocolate. She wanted to give her friend 3/7 of the chocolate. How many pieces did she give to her friend?

what vitamins are required to be on a nutrition label