Mady2357 Mady2357

Today at 10:27 PM
English

Answered

If you answer w a good sentence you get BRAINLIEST
need a good sentence for the word Providence
HURRY PLS

Answer :

collettejoyfranke collettejoyfranke

Today at 10:31 PM

Answer:

The church rejoices with them in the remarkable providence of God

Answer Link

BrooklynnAudellaJD BrooklynnAudellaJD

Today at 10:32 PM

Answer:

(often initial capital letter) the foreseeing care and guidance of God or nature over the creatures of the earth.

Explanation:

Answer Link

Other Questions

1. Native Americansused drumsto accompany song only in secular music. True False

17.31 x=173.1 decimal math

NO LINKS!!! What term describes art where the subject matter of the piece is not clearly identifiable? A. Symbolic B. Non-representational C. Synergistic D. Add

1. Native Americansused drumsto accompany song only in secular music. True False

1. Native Americansused drumsto accompany song only in secular music. True False

'All the World's a Stage' is written in 1 Slant Rhyme2 Free Verse3 Blank verse4 Internal Rhyme

Under which of the following operation rational numbers are not closed?

plzz ans. me... What is myogenic and neurogenic heart

the sum of a number and 1 added to it, multiplied by 2 is 10. what is the number?

An electronic conductor is

where do Tubal Ligation located

Help me please I don’t wanna fair math

5x+7x=180 a. 12=80 b. x=15 C.

All cells have the ability to replicate. True of false

Why does the government oversee the provision of public goods? Public goods are goods and services that tend to result in negative externalities; therefore, the

Transcribe the following Strand of DNA: GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

1 to 10 how good does my dog look healthy

The perimeter of a square-shaped rug is 36 meters. Find the length of each side.

All living things are made of

Agree or Disagree: The large scale immigration in California during the 20th century was a direct result of the religious pluralism in America during that time.