09329916 09329916

Today at 5:15 AM
Physics

Answered

a box is 4 m in the air and has 120 J of potential energy. What is the box's mass

Answer :

Other Questions

evaluate the expression 5x-2y when x=4, y=10

Which reaction releases the greatest amount of energy per kilogram of reactants? A) neutron + uranium-235 ➡️ barium-141 + krypton-92 + 3 neutrons B) 2C + H2 ➡️

The total amount of sodium in 2 hot dogs and 3 cups of cottage cheese is 4,720mg. The total amount of sodium in 5 hot dogs and 2 cups of cottage cheese is 6,300

One day of your walk home from school Sarah notice some rust on an old car she remembered that the chemical equations can summarize what happens in a chemical r

What is the volume of the following prism

Evaluate the expression: 1 ( 3 ) 21 \frac{1}{(\sqrt{3})^{21}

Pls help me with this one

"will you help me to move the piano ? "said my aunt .

1s 7. find the area of crossroads in the following figures. (a) (b) -6.3 cm (c) -6 cm 2.1 cm 3.3 cm 6 cm 2.1 cm 6.3 cm 3.3 cm

banana and grapes and water melon karnataka place name

Binding of an RNA binding protein will the stability of the RNA molecule. increase decrease neither increase nor decrease either increase or decrease

who was the carthaginian general who used elephants to cross the alps in the second punic war

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy

How many nucleotides are in 12 mRNA codons? 12 24 36 48

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of m

Which subunit of the E. coli polymerase confers specificity to transcription? Î± Î² Î²' Ïƒ

On average, children of cohabiting parents have slightly worse wellbeing than children of married parents. Which of the following has not been given as an expla

A straight section of silver wire has a cross sectional area A=2.0 mm2. A total of 9.4×1018 electrons pass through the wire in 3.0s. The conduction electron den

In which case did the U.S. Supreme Court raise the burden of proof for acts of juvenile delinquency from “preponderance of the evidence” to “beyond a reasonable