riverdale59 riverdale59

Today at 4:00 PM
Mathematics

Answered

Last week Mark ran 31 miles more than Jack. Mark ran 46 miles .How many miles did Jack run

Answer :

Аноним Аноним

Today at 4:04 PM

You take what Mark ran, 46 miles, and you see that Mark ran 31 more miles than Jack, so the equation would be 46-31, which would be 15 miles. So, Jack ran 15 miles.

Answer Link

amelia35 amelia35

Today at 4:05 PM

Mark ran 31 miles more than jack and mark ran 46
Then
46-31 = 15 miles

Answer Link

Other Questions

The line on a demand curve usually moves upward to the right. TRUE FALSE

Sophie drove 225 miles south through the smoky mountains. Snow during her return trip made her average speed on return trip 30 mph slower. The total driving tim

Which of these is an important aspect of management? A. enjoyment B. admiration C. appreciation D. inspiration

Sophie drove 225 miles south through the smoky mountains. Snow during her return trip made her average speed on return trip 30 mph slower. The total driving tim

Which of these is an important aspect of management? A. enjoyment B. admiration C. appreciation D. inspiration

Write a dialogue between two friends on the fears and anxiety of the SSC board exams

32gm of sulphur is completely burnt to get sulphur dioxide. The number of molecules of so2 obtained is1) 6 x 10232) 3 x 10233) 1.5 x 10234)7.5×1022

Sophie Ruth is eating a 50-gram chocolate bar which contains 30%, percent cocoa.

In the given figure, triangle ABC is a right angle triangle with ∠B = 90° and D is mid point of side BC. Prove that : AC² = AD² + 3CD²

Why would Russia have legitimate reason to be upset with Allied strategy in the European theater?

nathan had $25 to spend the carnival. he spent 60% of the money on food and drinks. how much money does nathan have left to spend on games.

what is the answer to this?

sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Each face of a six-sided cube is painted a different color. The cube is rolled twice and a coin is flipped. How many different possible outcomes exist? 13 24 36

Powers given specifically to crongress

3.26d+9.75d-2.65= helppppppppppppppp

Does anyone know how to get National Test Abhyas app in PC? PLS help!!!!!

How does the conclusion contribute to the overall text (paragraph 11-14)

why does the United States always favor the latter?